Top » Catalog » J1 » FGC4765

$18.00

FGC4765
[FGC4765]

FGC4765
hg38 Position: ChrY:13972156..13972156
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-YSC234
Comments: Downstream from YSC234
Forward Primer: FGC4765_F CAACTTGGAGGAGGCAGTG
Reverse Primer: FGC4765_R ATACTGCGCTTTTCTGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies