Top » Catalog » J1 » FGC14295

$18.00

FGC14295
[FGC14295]

FGC14295
hg38 Position: ChrY:2867157..2867157
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1a2b (not listed)
Comments: .
Forward Primer: FGC14295_F CCACCAAACAGAGCAGTGG
Reverse Primer: FGC14295_R AAGCTGAGAAAAGCGCTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC50904
1 x FGC8729
1 x BY40604
1 x FGC49174
1 x ALK486
1 x A19294
1 x FGC5429
1 x FGC22744
1 x A13648
1 x A20307
1 x FGC11
1 x FGC4278
1 x FGC4353
1 x FGC6035
1 x FGC34534
$270.00
Haplogroup Info
Other products
Currencies