Top » Catalog » J1 » FGC14295

$18.00

FGC14295
[FGC14295]

FGC14295
hg38 Position: ChrY:2867157..2867157
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1a2b (not listed)
Comments: .
Forward Primer: FGC14295_F CCACCAAACAGAGCAGTGG
Reverse Primer: FGC14295_R AAGCTGAGAAAAGCGCTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies