Top » Catalog » J1 » FGC37534

$18.00

FGC37534
[FGC37534]

FGC37534
hg38 Position: ChrY:17302155..17302155
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC6 > FGC4336
Forward Primer: FGC37534_F GGTGATAATTAACACTTGAGAGATTGG
Reverse Primer: FGC37534_R CCACTAGATTTATGGTAATTTGTTGC
Reviews

Customers who bought this product also purchased
FGC4354
FGC4354
FGC4347
FGC4347
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19930
1 x A20818
1 x FGC22751
1 x ALK443
$72.00
Haplogroup Info
Other products
Currencies