Top » Catalog » J1 » FGC37850

$18.00

FGC37850
[FGC37850]

FGC37850
hg38 Position: ChrY:7001948..7001948
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC6 > FGC37843
Forward Primer: FGC37850_F AATGGGGACAATAGCTCTCG
Reverse Primer: FGC37850_R GTTTGGTACCAGTGTCCCAAATAC
Reviews

Customers who bought this product also purchased
Z19217
Z19217
FGC37851
FGC37851
FGC37843
FGC37843
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC45010
1 x FGC5435
1 x FGC4282
1 x ALK27
1 x FGC1712
1 x ALK251
1 x FGC48146
1 x FGC34373
1 x FGC4354
1 x FGC1720
1 x BY107
1 x BY82
1 x FGC4705
1 x ALK257
1 x A22549
$270.00
Haplogroup Info
Other products
Currencies