Top » Catalog » J1 » FGC4354

$18.00

FGC4354
[FGC4354]

FGC4354
hg38 Position: ChrY:19368899..19368899
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC6 > FGC4355
Forward Primer: FGC4354_F GAATTGCTTTGGCTTTTAGGG
Reverse Primer: FGC4354_R CGCTTGAACCCTGGACAAG
Reviews

Customers who bought this product also purchased
FGC37534
FGC37534
FGC4347
FGC4347
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies