Top » Catalog » J1 » FGC38645

$18.00

FGC38645
[FGC38645]

FGC38645
hg38 Position: ChrY:7092117..7092117
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC37850
Forward Primer: FGC38645_F CTCCTGACCTCAGGTGATCC
Reverse Primer: FGC38645_R TGCACATCCTTTGTGAGAGC
Reviews

Customers who bought this product also purchased
FGC38649
FGC38649
FGC38648
FGC38648
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY67806
1 x FGC48143
1 x FGC4430
1 x FGC4792
1 x A22924
1 x FGC42773
1 x ALK431
1 x FGC7379
1 x FGC4738
1 x ALK473
1 x FGC5229
1 x A13637
1 x ALK609
1 x FGC8216
1 x FGC1718
1 x A19276
$288.00
Haplogroup Info
Other products
Currencies