Top » Catalog » J1 » FGC38645

$18.00

FGC38645
[FGC38645]

FGC38645
hg38 Position: ChrY:7092117..7092117
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC37850
Forward Primer: FGC38645_F CTCCTGACCTCAGGTGATCC
Reverse Primer: FGC38645_R TGCACATCCTTTGTGAGAGC
Reviews

Customers who bought this product also purchased
FGC38648
FGC38648
FGC38649
FGC38649
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK2
$18.00
Haplogroup Info
Other products
Currencies