Top » Catalog » J1 » FGC1709

$18.00

FGC1709
[FGC1709]

FGC1709
hg38 Position: ChrY:10243913..10243913
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC1709_F GCAGATACCATAAAACGAGTGTTC
Reverse Primer: FGC1709_R CGCCAAATGTGGAAATGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FGC38715
FGC38715
FGC38711
FGC38711
FGC1718
FGC1718
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC22259
$18.00
Haplogroup Info
Other products
Currencies