Top » Catalog » J1 » FGC1709

$18.00

FGC1709
[FGC1709]

FGC1709
hg38 Position: ChrY:10243913..10243913
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC1709_F GCAGATACCATAAAACGAGTGTTC
Reverse Primer: FGC1709_R CGCCAAATGTGGAAATGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FGC38715
FGC38715
FGC38711
FGC38711
FGC1718
FGC1718
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10416
1 x FGC6525
1 x FGC38711
1 x FGC10422
1 x FGC4338
1 x BY145
1 x A18553
1 x FGC1722
1 x FGC23929
1 x FGC5428
1 x FGC22248
1 x FGC8716
1 x FGC19506
1 x FGC1701
1 x FGC8726
1 x FGC16654
1 x A13632
1 x FGC23369
1 x FGC4465
1 x ALK480
1 x FGC22238
1 x ALK709
1 x ALK179
1 x FGC50847
$432.00
Haplogroup Info
Other products
Currencies