Top » Catalog » J1 » FGC38711

$18.00

FGC38711
[FGC38711]

FGC38711
hg38 Position: ChrY:19419034..19419034
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC38711_F ATCGGAAAAGCGCAGTCTC
Reverse Primer: FGC38711_R TGTCTCAACCAGAAAATGAAAGG
Reviews

Customers who bought this product also purchased
FGC38715
FGC38715
FGC1709
FGC1709
FGC1718
FGC1718
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47437
1 x CTS11741
1 x FGC5205
$54.00
Haplogroup Info
Other products
Currencies