Top » Catalog » J1 » FGC38715

$18.00

FGC38715
[FGC38715]

FGC38715
hg38 Position: ChrY:26381141..26381141
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC38715_F TGGTTGCATGGGTTTATTTCTAG
Reverse Primer: FGC38715_R GAGGCCGAGGCAAGAAG
Reviews

Customers who bought this product also purchased
FGC1718
FGC1718
FGC38711
FGC38711
FGC1709
FGC1709
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19335
1 x ALK279
1 x FGC4739
1 x FGC31322
1 x BY14469
1 x ALK213
1 x FGC29873
1 x FGC5441
1 x FGC5434
1 x FGC1721
1 x FGC10413
1 x FGC4416
$216.00
Haplogroup Info
Other products
Currencies