Top » Catalog » J1 » FGC5206

$18.00

FGC5206
[FGC5206]

FGC5206
hg38 Position: ChrY:21808658..21808658
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below Z640
Forward Primer: FGC5206_F CTTCAGGGTCGCCAAAAC
Reverse Primer: FGC5206_R GCTGTAACACTCACCATGAAGC
Reviews

Customers who bought this product also purchased
L858
L858
FGC59116
FGC59116
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC23369
FGC23369
FGC41680
FGC41680
FGC5235
FGC5235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC28714
1 x FGC4708
1 x FGC16721
1 x AMM394
1 x FGC8715
$90.00
Haplogroup Info
Other products
Currencies