Top » Catalog » J1 » FGC17485

$18.00

FGC17485
[FGC17485]

FGC17485
hg38 Position: ChrY:15113334..15113334
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1c (not listed)
Comments: Below ZS227 > FGC13864
Forward Primer: FGC17485_F GAGAAAGGTTATTTTTGCAGACG
Reverse Primer: FGC17485_R ACCCTAACCCACATAAGTGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20736
1 x BY65486
1 x FGC40454
1 x BY10490
1 x BY124800
1 x A14643
1 x FGC19465
1 x BY16791
1 x ALK871
1 x ALK864
1 x FGC34536
1 x ALK857
1 x FGC50888
1 x FGC17485
1 x FGC47843
1 x FGC8712
1 x FGC1713
1 x BY93
$324.00
Haplogroup Info
Other products
Currencies