Top » Catalog » J1 » FGC17485

$18.00

FGC17485
[FGC17485]

FGC17485
hg38 Position: ChrY:15113334..15113334
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1c (not listed)
Comments: Below ZS227 > FGC13864
Forward Primer: FGC17485_F GAGAAAGGTTATTTTTGCAGACG
Reverse Primer: FGC17485_R ACCCTAACCCACATAAGTGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK723
1 x Y19107
$36.00
Haplogroup Info
Other products
Currencies