Top » Catalog » J1 » FGC5230

$18.00

FGC5230
[FGC5230]

FGC5230
hg38 Position: ChrY:13416204..13416204
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below Z640
Forward Primer: FGC5230_F CTTGAGTGCTGTGGCATGAC
Reverse Primer: FGC5230_R AGTCTGGTTGAATTAAGATGATTGTG
Reviews

Customers who bought this product also purchased
FGC59170
FGC59170
FGC5229
FGC5229
ZS1482
ZS1482
ZS1431
ZS1431
BY162752
BY162752
BY74
BY74
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies