Top » Catalog » J1 » FGC34530

$18.00

FGC34530
[FGC34530]

FGC34530
hg38 Position: ChrY:7138207..7138207
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC1713 > ZS5804
Forward Primer: FGC34530v2_F CAACCAAAAAGAGTCCAGGATG
Reverse Primer: FGC34530v2_R AATTTATTGAGAGTTTTTAGCATGAACA
Reviews

Customers who bought this product also purchased
A19335
A19335
ZS11617
ZS11617
ZS5814
ZS5814
FGC1715
FGC1715
FGC40709
FGC40709
FGC1713
FGC1713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16726
1 x FGC50886
1 x FGC19189
1 x ALK875
1 x FGC6782
1 x FGC5240
1 x ALK4
1 x FGC4342
1 x FGC3747
1 x ALK901
1 x FGC10418
1 x FGC5454
1 x ALK391
1 x FGC10423
1 x FGC1709
1 x A17626
1 x A19277
1 x A19263
1 x BY154830
1 x A13649
1 x A20954
1 x BY25901
1 x FGC4288
$414.00
Haplogroup Info
Other products
Currencies