Top » Catalog » J1 » FGC30416

$18.00

FGC30416
[FGC30416]

FGC30416
hg38 Position: ChrY:20980021..20980021
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka ZS5871 Downstream FGC10500
Forward Primer: FGC30416_F TCCCATGGAAAGAACACTGAG
Reverse Primer: FGC30416_R CGGAAGCCATCATCCTCTG
Reviews

Customers who bought this product also purchased
FGC68219
FGC68219
YSEQ-Alpha
YSEQ-Alpha
L859
L859
FGC8703
FGC8703
FGC8712
FGC8712
FGC10500
FGC10500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC37834
$18.00
Haplogroup Info
Other products
Currencies