Top » Catalog » J1 » FGC8715

$18.00

FGC8715
[FGC8715]

FGC8715
hg38 Position: ChrY:16976581..16976581
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC1723 > L859 > FGC8703 > FGC8702
Forward Primer: FGC8715_F GATATTAAGGCCTCCCATTGC
Reverse Primer: FGC8715_R TCACCCAGGCTGGAAAGC
Reviews

Customers who bought this product also purchased
FGC11702
FGC11702
FGC9587
FGC9587
A22247
A22247
CTS8308
CTS8308
ZS4255
ZS4255
FGC10500
FGC10500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5216
1 x A22236
1 x FGC35899
1 x FGC5475
1 x FGC4286
1 x FGC4
1 x ALK205
1 x FGC8710
$144.00
Haplogroup Info
Other products
Currencies