Top » Catalog » J1 » FGC8715

$18.00

FGC8715
[FGC8715]

FGC8715
hg38 Position: ChrY:16976581..16976581
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC1723 > L859 > FGC8703 > FGC8702
Forward Primer: FGC8715_F GATATTAAGGCCTCCCATTGC
Reverse Primer: FGC8715_R TCACCCAGGCTGGAAAGC
Reviews

Customers who bought this product also purchased
ZS10562
ZS10562
L859
L859
ZS2085
ZS2085
ZS2094
ZS2094
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS5871
ZS5871
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies