Top » Catalog » J1 » FGC9581

$18.00

FGC9581
[FGC9581]

FGC9581
hg38 Position: ChrY:11071927..11071927
Ancestral: G
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC10500
Forward Primer: FGC9581v2_F AACGACAACAACAACAAAAACC
Reverse Primer: FGC9581v2_R GCCCTATGTTTATGTCAGCTCC
Reviews

Customers who bought this product also purchased
FGC65954
FGC65954
FGC65960
FGC65960
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC1731
1 x FGC8703
1 x FGC41248
1 x FGC40491
1 x A15545
1 x FGC9589
1 x FGC37840
1 x FGC5432
1 x A13634
1 x FGC22749
1 x FGC8725
1 x FGC10025
$216.00
Haplogroup Info
Other products
Currencies