Top » Catalog » J1 » FGC11

$18.00

FGC11
[FGC11]

FGC11
hg38 Position: ChrY:16470001..16470001
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1
Comments: Downstream from J1-L858*
Forward Primer: FGC11v2_F AGGAAGATCACTTGAGGTGAGG
Reverse Primer: FGC11v2_R CAAACAAATGAAACCCAGTCC
Reviews

Customers who bought this product also purchased
ZS7095
ZS7095
Y36224
Y36224
ZS7531
ZS7531
ZS7093
ZS7093
FGC4474
FGC4474
BY40741
BY40741
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies