Top » Catalog » J1 » FGC11

$18.00

FGC11
[FGC11]

FGC11
hg38 Position: ChrY:16470001..16470001
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1
Comments: Downstream from J1-L858*
Forward Primer: FGC11v2_F AGGAAGATCACTTGAGGTGAGG
Reverse Primer: FGC11v2_R CAAACAAATGAAACCCAGTCC
Reviews

Customers who bought this product also purchased
BY40741
BY40741
FGC50010
FGC50010
ZS10295
ZS10295
FGC60148
FGC60148
Y130515
Y130515
ZS2152
ZS2152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC1695
1 x BY152652
1 x A19217
$54.00
Haplogroup Info
Other products
Currencies