Top » Catalog » J1 » FGC12

$18.00

FGC12
[FGC12]

FGC12
hg38 Position: ChrY:12045625..12045625
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream from J1-L858 and FGC11
Forward Primer: FGC12v3_F GTAACTAACCTGCACATTGTGCAC
Reverse Primer: FGC12v3_R TATCAGATTAAGGAGATTTTCGACG
Reviews

Customers who bought this product also purchased
ZS11156
ZS11156
ZS8853
ZS8853
FGC50010
FGC50010
ZS10297
ZS10297
BY40741
BY40741
FGC4417
FGC4417
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47787
1 x FGC4296
1 x FGC4751
1 x FGC48153
1 x FGC4280
1 x ALK459
1 x A22234
1 x A23463
1 x BY53798
1 x A12922
1 x FGC14439
1 x FGC4761
1 x ALK464
1 x FGC22247
1 x FGC7393
1 x FGC4297
1 x A15547
$306.00
Haplogroup Info
Other products
Currencies