Top » Catalog » J1 » FGC12

$18.00

FGC12
[FGC12]

FGC12
hg38 Position: ChrY:12045625..12045625
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream from J1-L858 and FGC11
Forward Primer: FGC12v3_F GTAACTAACCTGCACATTGTGCAC
Reverse Primer: FGC12v3_R TATCAGATTAAGGAGATTTTCGACG
Reviews

Customers who bought this product also purchased
S20171
S20171
ZS4501
ZS4501
S21237
S21237
ZS4491
ZS4491
ZS5509
ZS5509
ZS3795
ZS3795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies