Top » Catalog » J1 » FGC4453

$18.00

FGC4453
[FGC4453]

FGC4453
hg38 Position: ChrY:13128741..13128741
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a1a1
Comments: Below L222.2 > FGC1721
Forward Primer: FGC4453v2_F TTTTCCACATTCCCCAAATC
Reverse Primer: FGC4453v2_R GGGGTCTTCGGGAATTTAAC
Reviews

Customers who bought this product also purchased
ZS5801
ZS5801
ZS9588
ZS9588
M168
M168
ZS7288
ZS7288
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
ZS7295
ZS7295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies