Top » Catalog » J1 » FGC42836

$18.00

FGC42836
[FGC42836]

FGC42836
hg38 Position: ChrY:19045877..19045877
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC42836_F TCTGGTGGGTTTACGGTCTG
Reverse Primer: FGC42836_R GTCTAGCTCAGGGATTGCAAAG
Reviews

Customers who bought this product also purchased
FGC42837
FGC42837
FGC42835
FGC42835
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK392
1 x FGC4451
1 x FGC4292
1 x FGC39179
1 x FGC22747
1 x FGC34247
1 x F4320
1 x CTS9501
1 x FGC40451
1 x FGC42458
1 x BY148572
1 x FGC48150
1 x FGC8224
1 x FGC49889
1 x FGC22259
1 x FGC39175
1 x FGC17483
1 x CTS8308
1 x ALK136
1 x A12920
1 x FGC4726
$378.00
Haplogroup Info
Other products
Currencies