Top » Catalog » J1 » FGC42836

$18.00

FGC42836
[FGC42836]

FGC42836
hg38 Position: ChrY:19045877..19045877
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC42836_F TCTGGTGGGTTTACGGTCTG
Reverse Primer: FGC42836_R GTCTAGCTCAGGGATTGCAAAG
Reviews

Customers who bought this product also purchased
FGC42835
FGC42835
FGC42837
FGC42837
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y3548
$18.00
Haplogroup Info
Other products
Currencies