Top » Catalog » J1 » FGC42828

$18.00

FGC42828
[FGC42828]

FGC42828
hg38 Position: ChrY:13285837..13285837
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: Below L858
Forward Primer: FGC42828_F AGCTTTTCACGAGTTAAAAAGAGG
Reverse Primer: FGC42828_R CTGATGTTTAAGGATGGTCTTGC
Reviews

Customers who bought this product also purchased
DYS533
DYS533
Wish a SNP
Wish a SNP
FGC42830
FGC42830
FGC42829
FGC42829
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies