Top » Catalog » J1 » FGC42829

$18.00

FGC42829
[FGC42829]

FGC42829
hg38 Position: ChrY:16540159..16540159
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: Below L858
Forward Primer: FGC42829_F TGGTTGTAGACATGTGGCATTAC
Reverse Primer: FGC42829_R CATCCTTTTTGTTGGTGTTGAAC
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
DYS533
DYS533
Wish a SNP
Wish a SNP
FGC42830
FGC42830
FGC42828
FGC42828
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18932
1 x FGC5
1 x A22918
1 x ALK341
1 x A24498
1 x ALK535
1 x FGC50949
1 x FGC40709
1 x FGC48100
1 x FGC10425
1 x ALK515
1 x FGC19505
1 x FGC20894
$234.00
Haplogroup Info
Other products
Currencies