Top » Catalog » J1 » FGC42830

$18.00

FGC42830
[FGC42830]

FGC42830
hg38 Position: ChrY:16959429..16959429
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: Below L858
Forward Primer: FGC42830_F CCAGGAGGAATTTGGAGATC
Reverse Primer: FGC42830_R CCAGGCTGCACTGGTATTTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FGC42829
FGC42829
FGC42828
FGC42828
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19272
1 x A23660
1 x FGC9583
1 x ALK354
1 x FGC22555
1 x FGC50884
1 x FGC1715
1 x FGC5426
1 x ALK426
1 x A13633
1 x ALK2
1 x FGC4385
1 x A23500
1 x FGC50010
1 x A20819
$270.00
Haplogroup Info
Other products
Currencies