Top » Catalog » J1 » FGC42830

$18.00

FGC42830
[FGC42830]

FGC42830
hg38 Position: ChrY:16959429..16959429
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: Below L858
Forward Primer: FGC42830_F CCAGGAGGAATTTGGAGATC
Reverse Primer: FGC42830_R CCAGGCTGCACTGGTATTTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FGC42829
FGC42829
FGC42828
FGC42828
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies