Top » Catalog » J1 » A31721

$19.00

A31721
[A31721]

A31721
hg38 Position: CP086569.1:40741844..40741844
Ancestral: C
Derived: T
Reference: Abdulrhman Alkhusaili (2022)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A31721_F GGGCACCCACAAACATACG
Reverse Primer: A31721_R CATTATAGGTAACATAGTATATATTGTATGTAACCG
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies