Top » Catalog » J1 » A34112

$19.00

A34112
[A34112]

A34112
hg38 Position: ChrY:20777074..20777074
Ancestral: A
Derived: G
Reference: YSEQ (2022)
ISOGG Haplogroup: J1
Comments: Below FGC7393 > Y154840
Forward Primer: A34112_F GGAGTGCAATGACCCAGC
Reverse Primer: A34112_R GCTAAGACCCTTCACAAGAATAACTG
Reviews

Customers who bought this product also purchased
J1-Y154840 Panel
J1-Y154840 Panel
A34108
A34108
A34107
A34107
A34106
A34106
A34111
A34111
A34105
A34105
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies