Top » Catalog » J1 » CTS4352

$18.00

CTS4352
[CTS4352]

CTS4352
hg38 Position: ChrY:13493686..13493686
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1
Comments: Downstream of L816
Forward Primer: CTS4352_F CTATTTATAGAAAGAAGATCCCCACAC
Reverse Primer: CTS4352_R GATTCCAGACACTGTATAAAACAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38645
1 x FGC4295
1 x FGC11723
1 x FGC16666
1 x FGC5225
1 x ALK358
1 x FGC5241
1 x CTS5551
1 x FGC29872
1 x BY13781
1 x A22922
1 x ALK534
1 x ALK870
1 x FGC50913
1 x FGC4347
1 x A14645
1 x ALK327
$306.00
Haplogroup Info
Other products
Currencies