Top » Catalog » J1 » CTS4352

$18.00

CTS4352
[CTS4352]

CTS4352
hg38 Position: ChrY:13493686..13493686
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1
Comments: Downstream of L816
Forward Primer: CTS4352_F CTATTTATAGAAAGAAGATCCCCACAC
Reverse Primer: CTS4352_R GATTCCAGACACTGTATAAAACAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies