Top » Catalog » J1 » FGC3723

$18.00

FGC3723
[FGC3723]

FGC3723
hg38 Position: ChrY:15926762..15926762
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC3723_F CCATTAACTAAGCTTTGAGCCAC
Reverse Primer: FGC3723_R CTGTGGGGAGTCTGTGCTTC
Reviews

Customers who bought this product also purchased
ZS9681
ZS9681
BY72
BY72
ZS2167
ZS2167
Z18243
Z18243
Z18253
Z18253
FGC8712
FGC8712
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC50904
1 x FGC8729
1 x BY40604
1 x FGC49174
1 x ALK486
1 x A19294
1 x FGC5429
1 x FGC22744
1 x A13648
1 x A20307
1 x FGC11
1 x FGC4278
1 x FGC4353
1 x FGC6035
1 x FGC34534
1 x A16980
$288.00
Haplogroup Info
Other products
Currencies