Top » Catalog » J1 » FGC3723

$18.00

FGC3723
[FGC3723]

FGC3723
hg38 Position: ChrY:15926762..15926762
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC3723_F CCATTAACTAAGCTTTGAGCCAC
Reverse Primer: FGC3723_R CTGTGGGGAGTCTGTGCTTC
Reviews

Customers who bought this product also purchased
L859
L859
BY40609
BY40609
ZS5868
ZS5868
FGC86271
FGC86271
Wish a SNP
Wish a SNP
FGC8715
FGC8715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies