Top » Catalog » J1 » FGC22247

$18.00

FGC22247
[FGC22247]

FGC22247
hg38 Position: ChrY:7114341..7114341
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22247_F GGAAGCCATGTTACATAGTCTGTTG
Reverse Primer: FGC22247_R ACTTTGTGATAATCCTCTTCAAAGC
Reviews

Customers who bought this product also purchased
ZS8592
ZS8592
FGC1707
FGC1707
S782
S782
ZS10334
ZS10334
L858
L858
FGC5419
FGC5419
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies