Top » Catalog » J1 » FGC22247

$18.00

FGC22247
[FGC22247]

FGC22247
hg38 Position: ChrY:7114341..7114341
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22247_F GGAAGCCATGTTACATAGTCTGTTG
Reverse Primer: FGC22247_R ACTTTGTGATAATCCTCTTCAAAGC
Reviews

Customers who bought this product also purchased
S782
S782
ZS10334
ZS10334
L858
L858
FGC5419
FGC5419
ZS6393
ZS6393
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies