Top » Catalog » J1 » FGC22247

$18.00

FGC22247
[FGC22247]

FGC22247
hg38 Position: ChrY:7114341..7114341
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22247_F GGAAGCCATGTTACATAGTCTGTTG
Reverse Primer: FGC22247_R ACTTTGTGATAATCCTCTTCAAAGC
Reviews

Customers who bought this product also purchased
ZS6395
ZS6395
FGC2
FGC2
ZS7716
ZS7716
ZS8547
ZS8547
FGC5
FGC5
FGC22259
FGC22259
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK341
$18.00
Haplogroup Info
Other products
Currencies