Top » Catalog » J1 » FGC22248

$18.00

FGC22248
[FGC22248]

FGC22248
hg38 Position: ChrY:7172264..7172264
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22248_F CCTGGCCTTTAATAAAAAGAATGC
Reverse Primer: FGC22248_R GGTAATAAACTTACCTTTGAGGATGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4284
1 x FGC4765
1 x ALK397
1 x BY172422
1 x BY161278
1 x A19269
$108.00
Haplogroup Info
Other products
Currencies