Top » Catalog » J1 » FGC22253

$18.00

FGC22253
[FGC22253]

FGC22253
hg38 Position: ChrY:13670806..13670806
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22253_F CCCATTGCCAAATTTATACACC
Reverse Primer: FGC22253_R AAGCAAAAACCCACCATTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4285
1 x FGC42837
1 x FGC4421
1 x A23687
1 x A16979
1 x BY200880
1 x FGC30570
1 x ALK367
1 x BY38105
1 x FGC39468
1 x FGC1703
1 x FGC30701
1 x FGC5224
1 x BY152331
1 x FGC10424
1 x A23886
1 x FGC3722
1 x FGC4480
1 x ALK174
1 x FGC4355
$360.00
Haplogroup Info
Other products
Currencies