Top » Catalog » J1 » FGC22253

$18.00

FGC22253
[FGC22253]

FGC22253
hg38 Position: ChrY:13670806..13670806
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22253_F CCCATTGCCAAATTTATACACC
Reverse Primer: FGC22253_R AAGCAAAAACCCACCATTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies