Top » Catalog » J1 » FGC22254

$18.00

FGC22254
[FGC22254]

FGC22254
hg38 Position: ChrY:14392110..14392110
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22254_F CTTCCTGAGTGGGGTAATGC
Reverse Primer: FGC22254_R CAACCCAGTAAAAACCCAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47834
1 x ALK877
1 x BY13768
1 x FGC4326
1 x BY108
1 x BY66740
1 x FGC22239
1 x FGC5420
1 x FGC31378
1 x A14886
1 x FGC44943
1 x FGC10612
1 x BY68
1 x FGC30567
1 x ALK364
1 x FGC43388
1 x FGC5437
1 x FGC43125
1 x BY181871
1 x FGC16639
$360.00
Haplogroup Info
Other products
Currencies