Top » Catalog » J1 » FGC22254

$18.00

FGC22254
[FGC22254]

FGC22254
hg38 Position: ChrY:14392110..14392110
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22254_F CTTCCTGAGTGGGGTAATGC
Reverse Primer: FGC22254_R CAACCCAGTAAAAACCCAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F1544
$18.00
Haplogroup Info
Other products
Currencies