Top » Catalog » J1 » FGC4474

$18.00

FGC4474
[FGC4474]

FGC4474
hg38 Position: ChrY:8724043..8724043
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC4
Comments: Downstream of J1-FGC4
Forward Primer: FGC4474vl_F ATTCAAGAGCCCCTGTGGAG
Reverse Primer: FGC4474vl_R CAGCTCTGATAGTCAGGTACCCTG
Reviews

Customers who bought this product also purchased
Y22089
Y22089
FGC1721
FGC1721
ZS7531
ZS7531
FGC11
FGC11
P58
P58
Y36224
Y36224
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies