Top » Catalog » J1 » FGC4474

$18.00

FGC4474
[FGC4474]

FGC4474
hg38 Position: ChrY:8724043..8724043
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC4
Comments: Downstream of J1-FGC4
Forward Primer: FGC4474_F AACAGTCAGGCCACCAAAAG
Reverse Primer: FGC4474_R AACATCAAGCACAGCCTCAG
Reviews

Customers who bought this product also purchased
FGC6770
FGC6770
FGC6782
FGC6782
FGC4486
FGC4486
BY145
BY145
ZS12072
ZS12072
ZS5198
ZS5198
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A13648
1 x FGC34537
$36.00
Haplogroup Info
Other products
Currencies