Top » Catalog » J1 » FGC4474

$18.00

FGC4474
[FGC4474]

FGC4474
hg38 Position: ChrY:8724043..8724043
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC4
Comments: Downstream of J1-FGC4
Forward Primer: FGC4474vl_F ATTCAAGAGCCCCTGTGGAG
Reverse Primer: FGC4474vl_R CAGCTCTGATAGTCAGGTACCCTG
Reviews

Customers who bought this product also purchased
ZS12046
ZS12046
ZS7093
ZS7093
Y30093
Y30093
BY145
BY145
FGC6770
FGC6770
FGC6782
FGC6782
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies