Top » Catalog » J1 » FGC5424

$18.00

FGC5424
[FGC5424]

FGC5424
hg38 Position: ChrY:12013927..12013927
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5424_F GCACTCTCTGTATTTCCCAAATG
Reverse Primer: FGC5424_R GCACATGTACCCTAAAACTTAACG
Reviews

Customers who bought this product also purchased
HU394
HU394
ZS5198
ZS5198
Z18219
Z18219
FGC4486
FGC4486
DNA Sample Kit
DNA Sample Kit
ZS5205
ZS5205
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19335
1 x ALK279
1 x FGC4739
1 x FGC31322
1 x BY14469
1 x ALK213
1 x FGC29873
1 x FGC5441
1 x FGC5434
1 x FGC1721
1 x FGC10413
1 x FGC4416
1 x FGC4486
1 x FGC4787
1 x ALK246
1 x FGC4240
$288.00
Haplogroup Info
Other products
Currencies