Top » Catalog » J1 » FGC5426

$18.00

FGC5426
[FGC5426]

FGC5426
hg38 Position: ChrY:13768937..13768937
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka ZS1792; downstream FGC5418
Forward Primer: FGC5426_F ATCCCAGAGAGCTTCAGGTATG
Reverse Primer: FGC5426_R CATTCAAGAGTAAAGGTGTAAGGAGG
Reviews

Customers who bought this product also purchased
FGC5427
FGC5427
FGC5424
FGC5424
Z18219
Z18219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10492
1 x FGC6538
1 x BY183285
1 x A17833
1 x FGC28714
1 x FGC4351
1 x ALK897
1 x A23679
1 x ALK106
1 x FGC39173
1 x A19211
1 x BY49997
1 x ALK14
1 x BY172199
1 x FGC1714
1 x FGC32851
1 x FGC36738
1 x FGC4346
1 x BY139133
1 x A24929
$360.00
Haplogroup Info
Other products
Currencies