Top » Catalog » J1 » FGC5441

$18.00

FGC5441
[FGC5441]

FGC5441
hg38 Position: ChrY:3023312..3023312
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Below FGC1
Forward Primer: FGC5441_F TCCCTCTGAAGACCTGGTAGG
Reverse Primer: FGC5441_R CTCCCTAGCCCTCCGTAAAC
Reviews

Customers who bought this product also purchased
ZS12329
ZS12329
FGC4453
FGC4453
ZS7093
ZS7093
Y30093
Y30093
FGC11
FGC11
ZS7091
ZS7091
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4292
1 x Z14146
$36.00
Haplogroup Info
Other products
Currencies