Top » Catalog » J1 » FGC22257

$18.00

FGC22257
[FGC22257]

FGC22257
hg38 Position: ChrY:15772932..15772932
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22257_F TGTGACCTACACATATACATCCAGATG
Reverse Primer: FGC22257_R CTGAGTAGCTAAGCATAGCCAGAC
Reviews

Customers who bought this product also purchased
FGC48018
FGC48018
FGC1695
FGC1695
FGC11
FGC11
ZS8177
ZS8177
S782
S782
FGC5424
FGC5424
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies